RegulonDB RegulonDB 10.8: Gene Sequence
yfcR gene sequence


Size: 513        A: 135  T: 126  G: 144  C: 108

Fasta

 

>yfcR E. coli K12. Version NC_000913.3 GI:556503834
atgacggggggagttatgagtcaaaagtttgtagtgggcgcagggctgctggtatgcagt
gtctgtagtttatctgctatggctggtagtaaacccgtggatttaattctgcgcgtgttg
gtcgatgctccgccaccctgttcaatcaagggcagccaggtagagttcggcaatatgatt
gctgataacgttgatggcaccaattatcggcaagatgcgaaatacacgttgaactgcaca
aacagtcttgctaacgacttgcggatgcaacttaagggcaatacctcaacgattaacggc
gaaacggtactcagtaccaatatcaccgggctgggcattcggatagaaaatagcgccgat
aactcattgtttgccgtcggtgaaaatagctggacgccatttaatatcaataaccagcca
cagttgaaggctgtacctgtgaaggcaagcggggcgcaacttgctgcgggcgagtttaac
gccagtttgaccatggtggtggactatcaatga
              
                            

Download fasta file
RegulonDB