RegulonDB RegulonDB 10.8: Gene Sequence
yfcU gene sequence


Size: 2646        A: 656  T: 621  G: 722  C: 647

Fasta

 

>yfcU E. coli K12. Version NC_000913.3 GI:556503834
atgcctgaccattctctttttcgattacggattcttccgtggtgcattgcgctggcaatg
tcagggagttatagcagtgtctgggctgaagacgacattcagtttgattcccgttttctg
gaattaaaaggcgacacaaaaattgatctgaagcgtttttccagccaggggtatgttgag
cccggaaaatacaatttacaggttcaactaaataaacagccattggcggaagagtacgat
atttactggtatgctggtgaagatgacgttagcaaaagctatgcttgtctgacaccggaa
ctggtggcgcagtttggtttaaaagaagacgtggcgaaaaatctgcaatggagccacgat
ggtaaatgcctgaagcccggtcaactggaaggcgtggaaattaaggctgatttaagccag
tccgcattagtcatttcactaccgcaggcttacctcgaatatacctggcccgactgggat
ccaccttctcgttgggatgatggcatctccgggatcattgcggactacagcatcactgcg
caaacacgacacgaagaaaatggcggcgatgacagtaacgagatcagcggcaacgggacg
gtcggggttaacctggggccatggcgtatgcgcgctgactggcagaccaactatcaacat
acgcgcagtaatgatgatgacgatgaatttggcggcgatgacacacaaaaaaaatgggag
tggagtcgctattatgcctggcgggcgttaccgtcattaaaagccaaactggcgctgggc
gaagattacctcaattccgatattttcgacggttttaattatgttggtggcagtgtcagc
actgacgatcaaatgttgcctcccaatctgcgcggctacgcgccagacatttccggcgtg
gcacacaccacagcaaaagtgaccgtcagccagatggggcgtgtgatttacgaaacgcag
gttccggctggaccgtttcgtattcaggatcttggtgattccgtctccggtacgttgcat
attcgcattgaagaacagaacggccaggtgcaggaatatgacatcagcaccgcctcgatg
ccatacctcactcgcccaggccaggttcgctataagatcatgatgggacgtccgcaagag
tggggccaccatgtcgaggggggatttttctctggtgctgaagcctcctggggcatcgct
aacggctggtcgttatatggcggtgcgctgggtgatgaaaactatcagtctgcggcgctg
ggcgtcggtcgcgatttgtctaccttcggcgcggtcgcgtttgatgttactcattcgcat
accaaactggataaagacaccgcttatggcaaaggttcgctggacggtaactccttccgt
gtgagttattccaaagactttgaccagctcaacagccgcgtcactttcgctggatatcgc
ttctcggaagagaactttatgaccatgagcgagtatctggatgccagtgacagcgaaatg
gtccgtacgggcaacgacaaagagatgtacaccgccacttataaccagaacttccgcgat
gcgggtgtttcggtttatctcaactatacccgccatacctactgggatcgtgaggagcag
acaaactacaacatcatgctctcccactatttcaatatgggcagcattcgtaatatgagc
gtttccctgactggctaccgctacgagtatgacaaccgggcggataagggcatgtagatt
tcgctcagtatgccgtggggcgacaacagtaccgttagctataacggcaactatggcagt
gggacggacagcagccaggtcggttattttagccgtgtcgatgacgcgactcactatcag
ttgaacatcggcaccagtgacaaacacaccagcgttgatggctactacagccatgatggt
tcgctggcgcaggttgacctcagtgcgaactaccatgaagggcaatacacctctgcgggc
ttgtcgttacagggcggcgcaacgcttactacccacggcggcgcacttcaccgtacccag
aatatgggcgggacacgcctgctgattgatgccgatggcgttgccgatgttccggtggaa
ggtaacggggctgctgtttataccaatatgtttggtaaagccgtcgtttctgacgttaac
aattattatcgcaatcaggcgtatatcgacctcaacaaattgccggaaaacgccgaagca
acccagtcggtggtgcaagccacgctaactgaaggagccattggctaccgcaaatttgcc
gtcatcagtggtcaaaaagcgatggcggtgctgcgtttacaagatggcagccatccaccg
tttggcgcagaagtaaaaaatgataacgagcagacagtgggccttgtcgatgatgacggt
agtgtctatctggctggggtgaaacctggcgaacatatgagtgtgttctggagtggtgtt
gcgcattgcgatatcaacctgccggacccgctgcctgccgatctgtttaacggcttgtta
ctgccatgccagcataaaggcaacgtcgcgccggttgttcctgatgacataaagcctgtc
attcaggagcagacgcaacaggtgacacccaccgatccccctgtttctgtttcagctaac
caataa
              
                            

Download fasta file
RegulonDB