RegulonDB RegulonDB 10.8: Gene Sequence
fadJ gene sequence


Size: 2145        A: 518  T: 506  G: 613  C: 508

Fasta

 

>fadJ E. coli K12. Version NC_000913.3 GI:556503834
atggaaatgacatcagcgtttacccttaatgttcgtctggacaacattgccgttatcacc
atcgacgtaccgggtgagaaaatgaataccctgaaggcggagtttgcctcgcaggtgcgc
gccattattaagcaactccgtgaaaacaaagagttgcgaggcgtggtgtttgtctccgct
aaaccggacaacttcattgctggcgcagacatcaacatgatcggcaactgcaaaacggcg
caagaagcggaagctctggcgcggcagggccaacagttgatggcggagattcatgctttg
cccattcaggttatcgcggctattcatggcgcttgcctgggtggtgggctggagttggcg
ctggcgtgccacggtcgcgtttgtactgacgatcctaaaacggtgctcggtttgcctgaa
gtacaacttggattgttacccggttcaggcggcacccagcgtttaccgcgtctgataggc
gtcagcacagcattagagatgatcctcaccggaaaacaacttcgggcgaaacaggcatta
aagctggggctggtggatgacgttgttccgcactccattctgctggaagccgctgttgag
ctggcaaagaaggagcgcccatcttcccgccctctacctgtacgcgagcgtattctggcg
gggccgttaggtcgtgcgctgctgttcaaaatggtcggcaagaaaacagaacacaaaact
caaggcaattatccggcgacagaacgcatcctggaggttgttgaaacgggattagcgcag
ggcaccagcagcggttatgacgccgaagctcgggcgtttggcgaactggcgatgacgcca
caatcgcaggcgctgcgtagtatcttttttgccagtacggacgtgaagaaagatcccggc
agtgatgcgccgcctgcgccattaaacagcgtggggattttaggtggtggcttgatgggc
ggcggtattgcttatgtcactgcttgtaaagcggggattccggtcagaattaaagatatc
aacccgcagggcataaatcatgcgctgaagtacagttgggatcagctggagggcaaagtt
cgccgtcgtcatctcaaagccagcgaacgtgacaaacagctggcattaatctccggaacg
acggactatcgcggctttgcccatcgcgatctgattattgaagcggtgtttgaaaatctc
gaattgaaacaacagatggtggcggaagttgagcaaaattgcgccgctcataccatcttt
gcttcgaatacgtcatctttaccgattggtgatatcgccgctcacgccacgcgacctgag
caagttatcggcctgcatttcttcagtccggtggaaaaaatgccgctggtggagattatt
cctcatgcggggacatcggcgcaaaccatcgctaccacagtaaaactggcgaaaaaacag
ggtaaaacgccaattgtcgtgcgtgacaaagccggtttttacgtcaatcgcatcttagcg
ccttacattaatgaagctatccgcatgttgacccaaggtgaacgggtagagcacattgat
gccgcgctagtgaaatttggttttccggtaggcccaatccaacttttggatgaggtagga
atcgacaccgggactaaaattattcctgtactggaagccgcttatggagaacgttttagc
gcgcctgcaaatgttgtttcttcaattttgaacgacgatcgcaaaggcagaaaaaatggc
cggggtttctatctttatggtcagaaagggcgtaaaagcaaaaaacaggtcgatcccgcc
atttacccgctgattggcacacaagggcaggggcgaatctccgcaccgcaggttgctgaa
cggtgtgtgatgttgatgctgaatgaagcagtacgttgtgttgatgagcaggttatccgt
agcgtgcgtgacggggatattggcgcggtatttggcattggttttccgccatttctcggt
ggaccgttccgctatatcgattctctcggcgcgggcgaagtggttgcaataatgcaacga
cttgccacgcagtatggttcccgttttaccccttgcgagcgtttggtcgagatgggcgcg
cgtggggaaagtttttggaaaacaactgcaactgacctgcaataa
              
                            

Download fasta file
RegulonDB