RegulonDB RegulonDB 10.9: Gene Sequence
intS gene sequence


Size: 1158        A: 345  T: 260  G: 298  C: 255

Fasta

 

>intS E. coli K12. Version NC_000913.3 GI:556503834
atgctcaccgttaagcagattgaagcagcaaagccgaaagaaaaaccataccgccttctc
gatggtaatggcctgtacctttatgtccctgtgtcagggaaaaaggtatggcagcttcgc
tacaagattgacggtaaggagaaaatcctgaccgtcggaaaatatccgcttatgactttg
caggaggcaagggataaagcatggactgcgaggaaagacatctcggttggcatcgatcct
gtaaaggcgaaaaaggcttcgtctaacaacaattcctttagtgcgatttacaaggaatgg
tacgagcacaagaagcaagtatggtcagtagggtatgcaactgaacttgccaaaatgttt
gacgacgacattttacctatcattggcggccttgaaattcaggatattgagccgatgcaa
ctgctggaagtaatccgcaggtttgaagatcgcggtgcaatggaacgagccaacaaagca
cgcagaagatgcggcgaggttttccgttacgctattgtcaccggaagggctaaatataac
ccggcacctgaccttgctgacgccatgaagggataccgcaagaagaacttcccgtttctt
cctgcagaccagatcccggcattcaacaaagcactggcaacattttcaggaagtatcgta
tcgctcattgcgaccaaagttttacgctacacagccctaagaacgaaagagcttcgttcc
atgctatggaagaacgtcgattttgaaaataggattatcaccatcgacgccagtgtgatg
aaaggacgcaaaattcatgtggttcctatgtcagaccaggtagttgaacttctcactacg
ctaagctccatcaccaaaccagtctcagagtttgtttttgccgggcgcaacgataagaag
aagccaatctgcgagaacgcggtactgcttgtgatcaaacaaatcggctatgagggtctg
gaaagcggtcacggattcaggcatgaattcagcacgattatgaacgagcacgaatggcct
gctgacgctattgaagtgcaactggcacatgcaaacggcggatctgtgcgtgggatttac
aaccatgctcagtatctcgataaacgcagagaaatgatgcaatggtgggcggactggctt
gatgagaaggtggagtga
              
                            

Download fasta file
RegulonDB