RegulonDB RegulonDB 10.8: Gene Sequence
yfdE gene sequence


Size: 1146        A: 321  T: 304  G: 287  C: 234

Fasta

 

>yfdE E. coli K12. Version NC_000913.3 GI:556503834
atgacaaataatgaaagcaaagggccgtttgaaggcttattagttatcgatatgacacat
gtccttaatggacctttcggaactcaacttctttgtaatatgggcgcaagggtaattaaa
gttgagccgccgggtcatggtgatgatacccgcacatttggtccctatgtggatggacag
tcactctattacagttttattaatcatggcaaagagagtgtggttcttgatttaaagaat
gatcacgataaaagtatatttataaatatgctcaaacaagctgatgtattagctgagaat
tttcgcccaggtacaatggaaaaactggggttttcatgggaaacgcttcaagaaatcaac
ccgcgcctcatatatgcttcatcgtcaggtttcggacataccggtccgctaaaagatgct
cctgcctacgataccatcattcaggcaatgagcgggataatgatggaaacaggatatcct
gatgctccgccagtgcgcgttggtacatctcttgcggatctatgcggcggtgtctattta
ttcagcggaatagtgagtgcactttatggccgcgaaaagagccagagaggggcgcatgtc
gatatagcgatgtttgatgccacgctgagttttctggagcatggtctgatggcatatatc
gcaactgggaagtcaccacaacgtctgggaaatcgccatccctacatggcaccttttgat
gttttcaatactcaggataagccgattacgatttgttgtggtaatgacaagcttttttct
gcgttatgccaggcactggagcttacggaactggttaatgatccccgatttagcagcaat
attttacgcgtacaaaaccaggctattcttaaacaatatattgagcggacgttaaaaacg
caggcagctgaagtttggttagccagaatacatgaagttggtgtacccgtcgcgccgtta
ttaagtgtggctgaggccattaaattgccacaaactcaggcgagaaatatgttgattgaa
gccgggggaataatgatgccgggtaatccgataaaaatcagcggctgcgcggacccgcat
gttatgccgggagcggcaacgctcgaccagcatggggaacaaattcgccaggagttctca
tcataa
              
                            

Download fasta file
RegulonDB