RegulonDB RegulonDB 10.8: Gene Sequence
yfdV gene sequence


Size: 945        A: 213  T: 309  G: 227  C: 196

Fasta

 

>yfdV E. coli K12. Version NC_000913.3 GI:556503834
atgctaacattttttattggcgatttattgcctattatcgtaatcatgctgttgggttat
tttagcggcagacgagaaacattttcagaagatcaagctcgggcatttaataaactggta
ttaaactacgcgcttcctgcggctctatttgtatctattactcgggcaaacagggaaatg
atttttgcggacactcgtctgacccttgtatcacttgtggttattgtcggatgtttcttt
ttctcctggttcggttgctacaaattttttaaacgtacccatgcagaagcagctgtatgt
gcattaattgcaggttcacctaccattggattcctggggtttgcagttctcgatcctatt
tatggtgattccgtatcaacaggtttagtggtagcaattatttctattattgttaacgca
attactattcctattggtctgtatttgctgaatccttcttcaggagcggatggtaagaag
aatagtaatctgagcgcattaatttctgcggcaaaggagccagtagtatgggcacctgtt
ctggcaacgatcctggtgttggttggggtaaaaattccggcagcatgggacccaaccttt
aatctgattgcgaaggctaactcaggggtagcggtattcgctgcggggttgactctggct
gcacataaattcgagttcagtgccgaaattgcttataacaccttcctgaagctgattctg
atgccactggcactgcttctcgttggtatggcatgtcatttgaacagcgaacatctgcag
atgatggtactggcaggcgcattaccgccggcattctccggaatcattattgccagccgg
tttaatgtctacacccgtactggtacagcgtcattggctgtgagcgtactgggctttgtc
gtcacggctcccttgtggatttatgtcagtcgactggtttcataa
              
                            

Download fasta file
RegulonDB