RegulonDB RegulonDB 10.8: Gene Sequence
oxc gene sequence


Size: 1695        A: 457  T: 448  G: 419  C: 371

Fasta

 

>oxc E. coli K12. Version NC_000913.3 GI:556503834
atgtcagatcaacttcaaatgacagatggtatgcatatcatcgttgaagcattaaaacag
aataatattgacactatttatggtgttgtaggtattcctgtgacggatatggcacgccat
gcccaggcggaaggcattcgttatattggttttcgtcatgagcagtcggcaggctatgcc
gctgcggcaagcggttttcttacccaaaaaccggggatctgcctgacagtttctgcgcca
ggattcctcaatggtttgaccgcattggccaacgcaacggtaaatggttttccgatgatc
atgattagcggctccagcgaccgcgcgatcgtcgacctacagcaaggtgattatgaagag
ctggaccaaatgaatgcggcaaaaccgtatgccaaagcagcatttcgcgttaatcagccg
caggatcttggcattgcattggcacgcgctatccgggtctctgtatcgggtcgccctggc
ggagtttatcttgatttgccagcaaatgtcctggccgcgacgatggaaaaagacgaagcg
ttaaccacgattgttaaagttgaaaatccgtcgccagcattattgccatgcccgaagtca
gtcactagcgcaatttcgcttttagcaaaagctgaacggccattaattatccttggcaaa
ggcgcggcgtattcacaagctgatgaacagcttcgtgaatttattgaaagtgctcagatt
ccattcctgccaatgtctatggcgaaagggatccttgaagatacgcatccactttctgcg
gcagctgcgcgttcgtttgccctggcaaatgctgacgttgtcatgcttgttggtgcacga
ctgaattggttattggcacacggtaaaaaaggatgggcggcagatacacagtttattcaa
ctggatattgaaccgcaggaaattgacagcaaccgccccattgctgtgccagtcgttggt
gatattgcatccagtatgcaaggtatgctggcagaactgaaacaaaacacatttacgact
ccactggtatggcgcgatattttaaatatccacaagcagcaaaatgcacaaaaaatgcat
gaaaaattaagtacagatactcaaccattaaattactttaatgcattaagtgctgtgcgc
gacgtattgcgcgagaaccaggatatttatttagttaatgaaggtgcaaataccctggat
aatgcacgaaatattattgatatgtataaaccacgtcgtcgtctggattgtggtacctgg
ggtgtcatgggcatcggtatgggctatgccatcggtgctagcgtgacttctggttctccg
gttgtcgccattgaaggtgatagtgcttttggtttcagtgggatggaaattgaaacgatt
tgtcgatataacctgccggtgacgatcgttatttttaataatggcggcatctacagagga
gacggtgttgatctcagtggcgctggtgcaccatcaccaacggatctgttgcaccatgca
aggtatgacaaattaatggatgcgtttcgtggcgttggctataacgtcaccacgacagat
gaacttcgtcatgctttaaccaccggtattcagtcgcgcaaaccgaccattattaatgtg
gtcatcgaccctgcagcaggaactgaaagtggccatattaccaaacttaacccaaaacaa
gtcgctggtaattaa
              
                            

Download fasta file
RegulonDB