RegulonDB RegulonDB 10.8: Gene Sequence
frc gene sequence


Size: 1251        A: 332  T: 330  G: 313  C: 276

Fasta

 

>frc E. coli K12. Version NC_000913.3 GI:556503834
atgtcaactccacttcaaggaattaaagttctcgatttcaccggtgtgcaatctggccca
tcttgtactcaaatgctggcctggtttggcgctgacgttattaaaattgaacgtcccggc
gttggtgacgtaacgcgtcaccagctgcgagatattcctgatatcgatgcgctttacttc
accatgcttaacagtaacaaacgttctattgagttaaataccaaaacagcggaaggcaaa
gaggtaatggaaaagctgatccgcgaagctgatatcttagtcgagaactttcatccaggg
gccattgatcacatgggcttcacctgggagcatattcaagaaatcaatccacgtctgatt
tttggttcgatcaaagggtttgatgagtgttcgccttatgtgaatgtaaaagcctatgaa
aacgttgctcaggcagcgggtggcgcggcatccactacgggtttttgggatggtccgccg
ctggtaagcgctgcagcgttgggtgacagcaacaccggaatgcatttgctgatcggttta
cttgctgctttgctgcatcgcgaaaaaacggggcgtgggcaacgagtcaccatgtcaatg
caggatgccgtattgaacctttgccgcgtgaaattacgtgaccagcagcgtctcgataaa
ttgggttatctggaagaatacccgcagtatccgaatggtacatttggtgatgcagttccc
cgcggtggtaatgcaggtggtggcggtcagcctggctggatcctgaaatgtaaaggctgg
gaaaccgatcctaacgcctatatttatttcactattcaggagcaaaactgggaaaacacc
tgtaaagccatcggcaaaccagaatggattaccgatccggcatacagtacagcccatgca
cgacagccacatattttcgatatttttgctgaaatcgaaaaatacactgtcactattgat
aaacatgaagcggtggcctatttgactcagtttgatattccttgtgcaccggttttaagt
atgaaagaaatttcacttgatccctctttgcgccaaagtggcagtgttgttgaagtggaa
caaccgttgcgtggaaaatatctgaccgttggttgtccaatgaaattctctgcctttacg
ccggatattaaagctgcgccgctattaggtgaacataccgctgctgtattgcaggagctg
ggttatagcgacgatgaaattgctgcaatgaagcaaaaccacgccatctga
              
                            

Download fasta file
RegulonDB