RegulonDB RegulonDB 10.8: Gene Sequence
yfdX gene sequence


Size: 636        A: 205  T: 137  G: 160  C: 134

Fasta

 

>yfdX E. coli K12. Version NC_000913.3 GI:556503834
atgaaacgtttaattatggccacgatggtcacagcaattctggcatcttcaactgtatgg
gctgctgataatgctccggtagcggcacaacagcaaactcagcaagttcagcaaacccag
aaaacggcagcggcagcagagcgtatctctgaacaaggtttatatgcgatgcgtgacgtg
caggtagcgcgcctggctctgtttcatggcgatccagaaaaggcaaaagaactgaccaat
gaagcttccgctttgctgtcagatgacagtaccgaatgggcaaagttcgctaagccaggt
aaaaagaccaatctcaatgatgaccaatatattgtcattaatgcatctgtcggaatttct
gagagttatgtagcaactcccgaaaaagaagccgcgataaaaattgccaatgaaaaaatg
gcgaaaggggataaaaagggcgcaatggaagagcttcgcctggccggtgttggcgtaatg
gaaaaccaatatctgatgccacttaaacagactcgtaatgcacttgctgatgcgcagaaa
ctgcttgataaaaagcaatactacgaggcaaacctggcgcttaaaggtgcggaagatgga
atcatcgtcgatagcgaagcactgtttgtgaactaa
              
                            

Download fasta file
RegulonDB