RegulonDB RegulonDB 10.8: Gene Sequence
ypdI gene sequence


Size: 276        A: 86  T: 79  G: 54  C: 57

Fasta

 

>ypdI E. coli K12. Version NC_000913.3 GI:556503834
atgaaagtaaacttaatacttttcagcttatttttattggtctctattatggcatgcaat
gtttttgcattttccatttcgggtggtggaagtgagaggagctataaagagactgaaaaa
acatcagcgatgacgaccacacactctacaaaacttcagccatcacaggcgattttgttt
aagatgagagaagatgcgccaccattaaacctcacagaagaaatgccgcccccttttccg
acaaaggcgaattatcttattcatcctgtgcgatag
              
                            

Download fasta file
RegulonDB