RegulonDB RegulonDB 10.8: Gene Sequence
yfdY gene sequence


Size: 243        A: 41  T: 85  G: 69  C: 48

Fasta

 

>yfdY E. coli K12. Version NC_000913.3 GI:556503834
atgattaatttatggatgtttctcgccctgtgtattgtctgcgtaagcggctacatcggt
caggtactgaacgtggtatcggcggtctcttctttcttcggcatggtgatcctcgctgca
ctcatttattacttcaccatgtggttaactggcggtaatgaactagtgacggggatattt
atgtttcttgccccggcttgtggcttgatgattcgctttatggtggggtatggcaggcgg
tag
              
                            

Download fasta file
RegulonDB