RegulonDB RegulonDB 10.8: Gene Sequence
pyrS gene sequence


Size: 1698        A: 401  T: 424  G: 446  C: 427

Fasta

 

>pyrS E. coli K12. Version NC_000913.3 GI:556503834
gtgcacgaaatattcaacatgctgctggcggtcttcgatcgggcagcgttaatgcttatc
tgcctgttctttctcatccgtatccgcctgtttcgcgaactgttgcacaagtcggcgcac
tccccaaaagaattgctcgccgttaccgccattttctcgctgttcgccctgttcagcacc
tggtccggcgttcccgtagaaggctcgctggtgaacgtacgtattatcgcggtgatgtcc
ggcgggattctgtttggcccgtgggtaggcatcattaccggcgtgattgcgggtattcac
cggtatttaattgatatcggcggcgtgacggcgatcccctgctttatcaccagcattctg
gcgggttgtatatcgggctggatcaacctgaaaatccccaaagcacagcgctggcgcgtc
ggtattctcggcggcatgttgtgtgagacgttgaccatgattctggtaattgtctgggca
ccaactaccgcgttggggatcgatatcgtctctaaaatcggcattccaatgatcctcggt
agcgtctgtatcggctttattgtgcttctggtgcaaagcgttgagggcgaaaaagaggcc
agcgccgcgcggcaggccaagctggcgctggatatcgccaacaaaacgctaccgctgttt
cgccatgtcaatagcgagtcattacgcaaggtctgcgaaattatccgcgatgacattcac
gccgatgcggtggcgattactaataccgatcatgtgctggcctatgttggcgtgggtgaa
cataactatcagaatggcgatgacttcattagcccgactacccgtcaggcgatgaattac
ggaaaaatcatcattaaaaacaatgatgaagcccaccgcacaccagagattcattccatg
ctggtgatcccattgtgggagaaaggggtcgtgaccggaacgctgaaaatttactactgc
cacgcgcatcagatcacctcgtcattacaggaaatggcggtcggtctgtcgcaaatcatc
tccacgcaactggaggtttcacgcgccgagcagctacgtgaaatggcaaataaggcagag
cttcgcgccctgcaaagcaaaattaatccccattttctgtttaacgctctgaacgctatt
tcatcgtcaatccgtctgaatccggataccgctcgccagttgatctttaatctgtcgcgt
tatctgcgctataacattgaattaaaagacgatgagcaaatcgatatcaaaaaagagctg
tatcaaattaaagactatattgccattgagcaggcccgctttggtgacaagctgacggtt
atctatgatattgatgaagaggtgaattgctgcattcccagcctgctgatccagccgttg
gtggagaacgccattgtccacggtattcagccttgcaaaggtaaaggcgttgtcaccatc
agcgttgcagagtgcggaaatcgggtacgcattgcggtgcgagataccgggcacggcatc
gatccaaaggtgattgagcgggtcgaagcgaatgaaatgccgggcaataaaattggcctg
ctgaatgtccatcatcgcgtgaagttattgtatggcgaggggctgcatatccgccgcctg
gagccggggacggaaattgcgttttacattcctaaccaacgcaccccagtcgcctcacag
gctacgttattgctttga
              
                            

Download fasta file
RegulonDB