RegulonDB RegulonDB 10.8: Gene Sequence
pyrR gene sequence


Size: 735        A: 207  T: 179  G: 177  C: 172

Fasta

 

>pyrR E. coli K12. Version NC_000913.3 GI:556503834
gtgaaagtcatcattgttgaagacgaattcctggcacaacaggaactgagctggctaatt
aaagagcacagccagatggagattgtcggcacctttgacgacggtctggacgtgttgaag
tttttgcagcataaccgcgtcgacgccatttttctggatatcaatattccgtcgctggat
ggcgtgttgctggcgcaaaacatcagccagttcgcccataaaccgtttattgtgttcatc
accgcgtggaaagaacatgcggtagaagcgtttgaactggaggcgtttgactacattctc
aaaccgtatcaggagtcacgtattaccgggatgctgcaaaaactggaagcggcctggcaa
caacagcagaccagcagtacgcctgccgcgacggtaacgcgtgagaatgacaccattaat
ctggtgaaagatgagcgaataatcgtcacgccaattaacgatatctattacgccgaagcg
cacgagaaaatgacctttgtctatacgcggcgtgaatcctacgtaatgccgatgaacatt
accgaattttgcagcaaactgccgccgtcgcattttttccgctgccatcgctcattttgt
gtcaatctgaacaaaatacgcgaaatcgaaccgtggtttaataacacctacattctgcga
ctgaaagatctggattttgaagtgccggtcagccgcagcaaagtgaaagaatttcgccag
ttaatgcatctttaa
              
                            

Download fasta file
RegulonDB