RegulonDB RegulonDB 10.8: Gene Sequence
ypdC gene sequence


Size: 858        A: 169  T: 229  G: 237  C: 223

Fasta

 

>ypdC E. coli K12. Version NC_000913.3 GI:556503834
atgaaagcaccaggcttgcccgccgatcaacaatttttcgccgatctgttcagcggcctg
gtgcttaacccgcaactactggggcgcgtctggtttgccagccagcctgcctcgttgccg
gtgggcagtttatgtattgattttccccgtctggatatcgtgctgcgcggcgaatacggc
aatctgctggaagcaaagcagcaacgtttggtggaaggagaaatgctgtttattccggcg
cgcgcggctaatttaccggtcaacaacaaaccggtgatgctgttaagcctggtgttcgct
ccgacctggcttgggttatcgttttacgatagccgcaccacgtcgttgttgcatcctgct
cgccagatccagcttcccagcctgcaacgcggtgaaggtgaagcgatgcttaccgccctc
acccatcttagccgttcgccgctggagcaaaatatcattcagccgctggtgttaagtttg
ctgcatctttgccgtagcgtggtgaatatgccgccgggcaattcgcagccgcgcggcgat
tttctctatcacagcatttgtaactgggttcaggataattatgcccagccgctcacccgc
gagagcgtggcgcagttttttaatatcacgcccaatcatctgtcaaaactgtttgctcag
catggaacgatgcgttttatcgagtatgtgcgttgggtgcgaatggcgaaggcgaggatg
attttgcagaaatatcatctgtcaattcatgaagtggcacagcgttgcggttttccggat
agcgactatttttgtcgcgttttccggcgtcagtttggtctgacgccgggagagtacagc
gcccgttttcagggctaa
              
                            

Download fasta file
RegulonDB