RegulonDB RegulonDB 10.8: Gene Sequence
fryA gene sequence


Size: 2496        A: 576  T: 542  G: 719  C: 659

Fasta

 

>fryA E. coli K12. Version NC_000913.3 GI:556503834
atgttaacgattcaatttctctgtcctttgcctaacggtctacatgctcgtccggcgtgg
gaacttaaagaacagtgcagccagtggcaaagcgaaatcacttttattaaccatcgccag
aacgcaaaggcagatgcgaaaagctcgctggcgctgattggcaccggcaccctatttaat
gacagttgcagcctgaacattagcggcagcgatgaagagcaggcgcggcgcgtgctggaa
gagtacatccaggtgcgctttatcgacagcgacagcgttcagcctacgcaggcagaactg
acggcgcatccgctgccgcgttcattaagccgccttaacccggatttactgtacggcaat
gtgctggcaagcggcgtcggcgtgggtacgctgaccctgttacaaagcgacagcctcgac
agttatcgggcaatccccgccagtgcgcaagattccacccggctggagcacagcctggca
acgcttgccgagcaactgaaccagcaattgcgtgagcgtgacggcgaaagcaaaactatc
ctcagcgcccatttgtcgctgattcaggatgatgaatttgcaggcaatatccgtcgcctg
atgacagaacagcatcaggggctgggggcggcgatcatcagcaatatggagcaggtttgc
gccaaactttctgcctctgccagcgattatctgcgcgaacgtgttagcgacattcgcgat
atcagcgaacagttgctgcatatcacctggccggaactgaagccgcgcaacaagctggtg
cttgaaaaaccgaccattctggtggctgaagatttaaccccaagccagtttttgagcctt
gatttgaaaaatcttgcgggcatgattctggagaaaaccgggcgcacctcgcatacactg
attctggcccgtgcctcggcgatcccggtactgagtggcttgccgctggatgcgattgcc
cgttatgccgggcaacctgcagtgcttgacgcccagtgcggcgtgctggcgattaacccg
aatgacgcggtgagcggttattatcaggtcgcgcagacgctggcggataaacgccaaaaa
caacaggcgcaggctgccgcgcagctggcctattcccgtgataacaagcgtattgatatt
gcggcgaatatcggcaccgctctggaagcgccaggcgcgtttgccaacggcgcggaaggt
gtcgggctgttccgtaccgaaatgctctatatggatcgcgacagcgcgccggacgagcag
gagcaatttgaagcctaccagcaggtgctactggcggcgggcgacaagccgattatcttc
cgcacgatggacatcggcggcgataaaagcattccttatctgaatattccccaggaagag
aacccgttcctcggctatcgcgcggtacgtatttacccggaatttgctggcctgttccgc
actcaactgcgggccattttgcgcgccgccagtttcggcaacgcccagttgatgatcccg
atggttcacagcctcgatcagatcttatgggtgaaaggcgagatccaaaaagcgatcgtt
gagcttaagcgcgatggcctgcgtcatgcagagacgattacgcttgggatcatggtggaa
gttccgtcggtgtgctacatcatcgaccacttctgcgatgaggtcgatttcttcagtatc
ggctccaacgatatgacccagtatctgtatgcggtcgatcgtaataacccgcgcgtatcg
ccgctatataacccgattacgccatcgttcctgcgcatgttgcagcaaatagttaccact
gcgcatcagcggggcaaatgggtaggcatttgcggtgaactgggcggtgaaagccgttat
ctgccgctactgcttgggctgggcctggatgagctgagtatgagtagcccgcgtattccg
gcggtgaaaagccagcttcgtcaactggatagcgaggcgtgtcgggaactggcgcgtcag
gcatgtgaatgccgcagtgcgcaggaaattgaagcgttactcaccgcctttacgccggaa
gaagacgttcgcccactgctggcgctggagaatatctttgttgatcaggattttagcaat
aaagagcaggcgatccagttcctgtgcggcaacctcggcgttaacgggcgcactgaacat
ccgtttgagctggaagaagatgtctggcagcgggaagagattgttaccaccggcgttggt
tttggcgtagcgatcccgcacaccaaatctcagtggatccgtcattccagtatcagcatt
gcccggctggcgaaaccgattggctggcagtcagaaatgggcgaagtcgaactggtgatc
atgctgacgctgggtgctaacgaagggatgaatcatgtgaaagtcttctcgcagctggcg
cgtaaactggtgaataaaaacttccgccagtcgttgtttgccgcgcaagatgcacaaagt
atcctgacgctgctggaaacagaattaaccttctga
              
                            

Download fasta file
RegulonDB