RegulonDB RegulonDB 10.9: Gene Sequence
zipA gene sequence


Size: 987        A: 234  T: 209  G: 266  C: 278

Fasta

 

>zipA E. coli K12. Version NC_000913.3 GI:556503834
atgatgcaggatttgcgtctgatattaatcattgttggcgcgatcgccataatcgcttta
ctggtacatggtttctggaccagccgtaaagaacgatcttctatgttccgcgatcggcca
ttaaaacgaatgaagtcaaaacgtgacgacgattcttatgacgaggatgtcgaagatgat
gagggcgttggtgaggttcgtgttcaccgcgtgaatcatgccccggctaacgctcaggag
catgaggctgctcgtccgtcgccgcaacaccagtaccaaccgccttatgcgtctgcgcag
ccgcgtcaaccggtccagcagccgcctgaagcgcaggtaccgccgcaacatgctccgcat
ccagcgcagccggtgcagcagcctgcctatcagccgcagcctgaacagccgttgcagcag
ccagtttcgccacaggtcgcgccagcgccgcagcctgtgcattcagcaccgcaaccggca
caacaggctttccagcctgcagaacccgtagcggcaccacagcctgagcctgtagcggaa
cctgctccagttatggataaaccgaagcgcaaagaagcggtgattatcatgaacgtcgcg
gcgcatcacggtagcgagctaaacggtgaactgcttcttaacagcattcaacaagcgggc
ttcatttttggcgatatgaatatttaccatcgtcatcttagcccggatggcagcggcccg
gcgttattcagcctggcgaatatggtgaaaccgggaacctttgatcctgaaatgaaggat
ttcactactccgggtgtcactatctttatgcaggtaccgtcttacggtgacgagctgcag
aacttcaagctgatgctgcaatctgcgcagcatattgccgatgaagtgggcggtgtcgtg
cttgacgatcagcgccgtatgatgactccgcagaaattgcgcgagtaccaggacatcatc
cgcgaagtcaaagacgccaacgcctga
              
                            

Download fasta file
RegulonDB