RegulonDB RegulonDB 11.0: Gene Sequence
murR gene sequence


Size: 858        A: 231  T: 184  G: 235  C: 208

Fasta

 

>murR E. coli K12. Version NC_000913.3 GI:556503834
atgttgtacctgacgaaaataagcaatgcggggagtgaattcaccgaaaacgagcaaaaa
atcgctgactttctgcaggccaacgtgagtgagctgcaatccgtttcttcacggcagatg
gcgaaacagctcggcattagccagtcgagcatagtgaaatttgcccaaaaactcggcgcg
caaggatttactgaattgcgtatggcgttaataggcgaatacagtgccagccgggagaaa
acgaatgccacggcactgcacctgcacagttcgattaccagtgatgattcgctggaagtg
atcgcgcgcaaactgaatcgcgaaaaagagctggcgctggagcaaacctgcgcgttgctc
gattacgcgcggctgcaaaaaatcattgaggtcatcagtaaagcaccgtttatccagata
acgggcctgggcggatcggcgctggtggggcgcgatctgtcgttcaaactgatgaaaatt
ggctatcgcgtggcctgcgaagccgacacgcacgtacaagccaccgtttctcaggcgttg
aaaaaaggcgatgtacaaatcgctatctcttacagcggcagtaaaaaagagattgtcttg
tgcgcagaagcggcacgaaagcagggggcaacggtgattgccattacttctctgactgac
tctccgctgcggcggctggcgcatttcaccctcgataccgtttccggagaaaccgaatgg
cgtagctcgtcgatgtctacccgcacggcgcaaaattctgttaccgatttactgtttgtt
ggccttgtgcaactcaatgatgtggagtcattgaaaatgattcagcgcagcagtgagcta
acacaacgcctgaaatga
              
                            

Download fasta file
RegulonDB