RegulonDB RegulonDB 10.10: Gene Sequence
murQ gene sequence


Size: 897        A: 219  T: 198  G: 268  C: 212

Fasta

 

>murQ E. coli K12. Version NC_000913.3 GI:556503834
atgcaatttgaaaagatgattactgaaggctcgaacaccgcctcggctgaaattgaccgc
gtatcgacgctggaaatgtgccggattatcaacgatgaagataaaaccgtaccgcttgcc
gttgagcgcgtactgccggatatcgccgcggcgatcgatgttatccacgcccaggtaagc
ggcggcgggcgtctgatttacctcggtgcgggaacatccggtcgtctggggattctggat
gccagcgaatgtccgcccacctacggcgtgaaaccgggtctggtggttggtttgattgct
ggcggcgaatatgccattcagcacgcggtggaaggcgcggaagatagccgggaaggcggt
gttaatgatctgaaaaatattaatttaacggcacaggatgtggtggttggcattgctgcc
agcggtcgcacgccgtatgtgattgccggactggaatacgcacgccagctcggctgccgc
acagtgggaatttcctgtaatccggggagcgccgtttcaaccaccgctgagtttgccatt
acaccgattgtaggtgccgaagttgttaccggttcttcgcggatgaaagcaggtacagcg
cagaaactggtgctcaatatgctttccaccgggctgatgattaaatccggcaaagtgttc
ggcaacctgatggtcgatgtggtcgccaccaacgaaaaactgcatgtgcgacaggtcaat
attgttaaaaacgccaccggatgtagcgcagagcaagcggaagcggcgttaattgcttgc
gagcgcaactgtaaaacggccattgtgatggtgctgaaaaatctcgatgccgcagaagct
aaaaaacgcctggatcaacacggcggctttattcgtcaggttttagacaaggaataa
              
                            

Download fasta file
RegulonDB