RegulonDB RegulonDB 10.8: Gene Sequence
ypeA gene sequence


Size: 426        A: 99  T: 107  G: 139  C: 81

Fasta

 

>ypeA E. coli K12. Version NC_000913.3 GI:556503834
atggagatacgcgtatttcgccaggaagatttcgaagaggtcatcaccctttgggagcgt
tgcgacttgctgcgtccgtggaacgatccggaaatggacatcgagcgtaagatgaaccat
gacgtcagtttgtttttggtcgctgaggtaaacggtgacgtggtcggaacggtgatgggc
ggttatgacgggcatcgcgggtctgcttattatcttggcgtgcatccagagtttcgtggg
cgtgggattgccaatgcgttgcttaatcggctggagaaaaagctgattgctcgtggctgc
ccgaaaattcagatcaatgtgccggaagataacgacatggtgctcggaatgtatgaacgc
ctgggatatgaacacgccgacgtgctgagtctgggtaagcgtttgattgaagatgaagag
tactga
              
                            

Download fasta file
RegulonDB