RegulonDB RegulonDB 10.9: Gene Sequence
hyfF gene sequence


Size: 1581        A: 278  T: 451  G: 438  C: 414

Fasta

 

>hyfF E. coli K12. Version NC_000913.3 GI:556503834
atgagttattctgtgatgttcgctttactcctgctcacgccgctgcttttttcgctgctc
tgttttgcctgccggaaacggagactttctgcgactcgcacggtgaccgtattacatagc
ttagggatcacactgctgctgattctggcactctgggtggtccaaactgccgctgatgca
ggagaaatattcgctgcgggactgtggcttcatattgatggtctgggcggtttgttcctc
gccattcttggtgtgattggctttctcaccggtatttactcgattggctacatgcgtcat
gaagtggcacacggcgagctttcacccgttacgctgtgcgattactacggtttcttccat
ctgtttttgttcaccatgctgctggttgttaccagcaataacctgattgtgatgtgggcg
gcgatcgaagccaccaccttaagctcggcgtttctggtaggcatttacggtcagcgttca
tcgctggaagctgcatggaagtacatcattatttgtactgttggtgtcgcttttggtctg
ttcggtaccgtgctggtatacgccaacgccgccagcgttatgccgcaggcagaaatggcg
atattctggagcgaggttcttaagcaatcgtccttgcttgacccaacattaatgctgttg
gcctttgtgtttttgctaattggctttggtaccaaaaccgggctatttcccatgcacgcc
tggctgccggatgctcacagtgaagcgccgagtccggtcagcgccctgctctccgccgta
ttgctgaactgcgcgctgttggtgctgattcgctattacatcattatttgccaagccatc
ggcagcgatttccccaaccggttgttgctcatcttcggcatgttgtcggttgccgtggcg
gcatttttcattctggtacagcgggacattaagcgtctgctggcgtactccagcgtggag
aacatggggctggtcgcggtggagctaggcattggcgggccgctgggaatttttgccgcg
ctgctgcacatcttaaaccacagtctggcaaaaacgctgctgttctgcggttccggcaat
gtactgctcaagtacggcacgcgcgatctcaacgtcgtctgtgggatgctcaaaatcatg
ccatttaccgccgtgctgtttggcggcggtgcgctggcgctggcagggatgccgcccttc
aacatttttcttagcgaatttatgaccattaccgccggactggcacgtaatcacctgctg
attatcgtcctgctgttattgctgttaacgctggtgctggcgggcctggtacggatggct
gcgcgggtgttaatggcgaaaccgccgcaggccgttaaccggggtgatctcggctggttg
accacctcgccaatggtgattctgctggtcatgatgctggcgatgggaacgcatattcca
caacctgtcatcaggatcctggcgggcgcttccactatagtcctctcagggacgcacgat
ctgcctgcacaacgtagcacctggcatgattttttgccttcaggcaccgcatctgtttcg
gagaaacacagtgaacgttaa
              
                            

Download fasta file
RegulonDB