RegulonDB RegulonDB 10.9: Gene Sequence
hyfR gene sequence


Size: 2013        A: 476  T: 478  G: 539  C: 520

Fasta

 

>hyfR E. coli K12. Version NC_000913.3 GI:556503834
atggctatgtcagacgaggcgatgtttgccccgccacaaggaataacaattgaagcggta
aacggaatgctcgcggagcggttagcacagaaacacggcaaggcgtctttattacgcgcc
ttcatcccgctgccgccgccgttcagcccggtacaacttattgaactgcatgttctcaaa
agcaacttctattaccgctaccatgatgatggcagcgatgtgacggcaacaacagagtat
cagggcgagatggtcgattattcgcgtcacgccgtccttctcggcagtagtggaatggcg
gagctacgctttattcgcacccacggcagtcgttttacttcccaggattgcacactgttt
aactggctggcgcggataatcaccccggttctgcaatcatggctcaatgatgaagaacag
caggtggcgctgcgtttgctggagaaagatcgcgatcatcatcgggtactggttgatatt
actaatgcagtgctgtcacatcttgatctcgacgatctgatcgctgacgtcgctcgtgag
atccatcattttttcggtctggcttcagtcagtatggtactgggcgatcatcgaaagaac
gagaagttcagcctgtggtgcagcgatctttctgcctcacattgtgcgtgtctgccacgc
tgtatgcctggcgaaagtgtattgctgacacaaacgctacaaacccgacaaccgaccttg
acgcaccgtgcagatgatctgtttctctggcaacgcgacccgttattactcttacttgca
tctaacggctgcgaatctgcgctccttataccgcttacctttggcaaccatacaccgggt
gcattgttgctggcgcatacctcttccactctctttagtgaggaaaactgccagctacta
caacacatagccgatcgcatcgctattgccgttggcaatgccgatgcctggcgtagcatg
accgatttgcaggaaagtttgcagcaagaaaaccaccagcttagcgagcagctcctttcg
aatctgggcatcggtgacattatctatcaaagccaggcaatggaagacctgctccagcag
gtagatattgtggcgaagagcgacagtacggtgttgatttgtggtgaaaccggaactggc
aaagaggtgatcgccagagcgatccatcaacttagcccgcgacgcgacaagccgctggtc
aaaatcaactgcgctgccatccccgccagtcttctggaaagtgagttattcggtcatgac
aaaggggcgtttactggtgcgattaatacccatcgtggtcgttttgaaattgccgatggc
ggcacgttgtttctcgatgaaattggcgatctgccgttagaacttcagcctaaactgctg
cgcgtattgcaggagcgggagattgagcgtctcggcgggagtagaacgatcccggtgaat
gtcagagtcattgccgccaccaaccgtgatttgtggcaaatggttgaagatcgccagttt
cgcagcgatctcttttatcgcctgaatgtcttcccactggaattgccgccgctacgcgac
cgtccggaagatatccctcttttagcaaaacatttcacgcaaaaaatggcgcgccatatg
aatcgcgcaattgacgccatcccgaccgaggcactacgccagttgatgtcgtgggattgg
ccgggcaacgtgcgcgagctggaaaacgtgattgagcgggcggtactgttgactcgtggt
aacagtctgaatttacatctaaatgtccgacaaagccgtttactgccgacgctaaatgaa
gattcagcgcttcgcagttcaatggcgcagttactgcacccgacgacgccagagaatgac
gaagaagaacgtcagcgcattgttcaggtattgcgagaaaccaatggcattgttgccggg
ccccgtggcgcagcgacgcgattagggatgaagcgcaccacgctgctgtcacgaatgcag
cggctggggatctcggttcgcgaggtgttgtaa
              
                            

Download fasta file
RegulonDB