RegulonDB RegulonDB 10.10: Gene Sequence
focB gene sequence


Size: 849        A: 158  T: 256  G: 228  C: 207

Fasta

 

>focB E. coli K12. Version NC_000913.3 GI:556503834
atgagaaacaaactctctttcgacttgcagttgagcgccagaaaagcggcaatcgctgaa
cggattgccgcccataaaattgcccgcagtaaagtgtcggtctttttaatggcgatgtcc
gctggcgtgtttatggcgatcggatttactttttacctttccgttatcgccgatgccccg
tcttcacaggcattaacccatctggtgggcggcctttgctttacactcggctttattttg
ctggcggtttgcggcaccagcctgttcacctcgtcggtaatgacggtgatggcaaaaagt
cggggcgttattagttggcgaacttggctgattaacgcacttctggtggcctgcggtaat
ctggcaggtattgcctgtttcagtttgttaatctggttttccgggctggtgatgagtgaa
aacgcgatgtggggagtcgcggttttacactgcgccgagggcaaaatgcatcatacattt
actgaatctgtcagcctcggcattatgtgcaatctgatggtttgcctggcgctgtggatg
agttattgcgggcgttcgttatgcgacaaaatcgtcgccatgattttgcccatcaccctg
tttgtcgccagtggctttgagcactgtatcgccaatttgtttgtgattccgttcgccatt
gccattcgccatttcgcccctccccccttctggcagctggcgcacagtagcgcagacaat
tttccggcactgacggtcagccattttattaccgccaatctgctcccggtgatgctgggt
aatattatcggcggtgcggtgctggtgagtatgtgttatcgggctatttatttacgtcag
gaaccctga
              
                            

Download fasta file
RegulonDB