RegulonDB RegulonDB 10.9: Gene Sequence
pdeF gene sequence


Size: 2244        A: 534  T: 664  G: 538  C: 508

Fasta

 

>pdeF E. coli K12. Version NC_000913.3 GI:556503834
atgaaactgaatgcaacttatataaaaatacgtgataaatggtgggggcttccgctgttc
ctgccttctttaatcttgcccattttcgcccacattaatactttcgcgcatatttcttcc
ggtgaggtttttctcttttatctgcctctggcactgatgatcagcatgatgatgtttttc
agctgggcggcattgccagggatcgccttagggatttttgtccgcaaatatgcagagctg
ggtttttacgaaacgctatcattaacggctaattttattatcattatcattctctgttgg
ggcggttacagggtctttactccccggcgtaacaacgtttcacatggtgatacccgttta
atttcccagcgtatattctggcagattgtgtttcctgcaacgctgtttctgatacttttc
cagtttgctgcatttgtaggattactggcgagcagagaaaatctggtcggtgtcatgcct
tttaacctcgggactttaatcaattatcaggccttactggtgggtaatctgatcggtgtc
ccgctgtgctacttcatcattcgggtagtgcgaaatccattttatttacgtagctattat
tcgcaattaaaacagcaggttgatgccaaagtcaccaaaaaagagttcgcgctctggcta
ctggcattaggtgctttattgttgctgttatgcatgccgttaaatgaaaaaagcacaatt
tttagcaccaattataccttgtcattattgctgcccctgatgatgtggggagcgatgcgc
tatggttataagctgatttcgctgctctgggcggtcgtgttgatgatcagcatccacagc
tatcaaaattacattcccatttatcctggctataccacgcagctgaccataacctcctcc
agttatctggtattctcttttattgtcaattatatggctgtactggcaacccgtcagaga
gcggtagtcagacgcattcagcggcttgcgtatgtggacccggtggttcatctgccaaat
gttcgcgccctgaatcgcgcgttgcgtgatgccccctggtctgcgctttgttatttacgc
atccctggcatggaaatgctggttaagaactatggcatcatgctgcggattcaatacaag
caaaaactttctcactggctgtcacccttgctggaaccgggtgaagatgtttatcagctt
tcgggtaacgatctcgcgctgcgactgaatacagaatcgcaccaggagcgcattaccgca
ctggatagccatctcaagcaatttcgtttcttttgggatggcatgccgatgcaaccgcag
attggcgtcagttactgctatgtgcgctcgccagtgaatcatatctacctgctgctggga
gagctaaatacggtcgccgaactttccatcgtgaccaacgccccggaaaatatgcagcgt
cgcggggcaatgtatttgcaacgcgaattgaaagataaagtcgcgatgatgaatcgacta
cagcaggcgctggaacacaaccattttttcctgatggcccagccgattaccggtatgcgt
ggtgatgtttaccatgaaattcttctgcgcatgaaaggtgagaatgatgaactgatcagc
cccgatagcttcttgccggtcgcgcacgaatttggtttatcgtcgagtatcgacatgtgg
gtcattgagcatacgctgcaatttatggctgaaaacagagcgaagatgcccgctcaccgt
tttgctattaatctgtctccaacctcggtatgtcaggctcgttttcctgttgaagtcagt
cagttgctggctaaatatcagattgaagcgtggcaacttatttttgaagtcaccgaaagt
aatgctctgaccaatgttaagcaggcgcaaatcaccttgcagcatcttcaggaattaggc
tgccagattgcgattgatgatttcggcaccggctacgccagctatgcgcggcttaaaaat
gtgaatgccgatctgcttaaaattgacggcagttttatccgcaatattgtgtcaaatagt
ctggattatcagatagtggcatcgatttgccacctggcgcgaatgaagaaaatgctggta
gtggcagagtacgttgaaaacgaagagatccgcgaggcggtgctctctttggggatcgat
tatatgcagggttatcttattggtaagccgcagccgttaattgatacgctgaatgaaatc
gaacccattcgcgaaagtgcctga
              
                            

Download fasta file
RegulonDB