RegulonDB RegulonDB 10.8: Gene Sequence
der gene sequence


Size: 1473        A: 361  T: 343  G: 425  C: 344

Fasta

 

>der E. coli K12. Version NC_000913.3 GI:556503834
atggtacctgtggtcgcgcttgtcgggcgccctaacgtaggaaaatccacgttatttaac
cgtctaactcgcacccgagatgcgctggttgcggatttcccgggtctgactcgtgaccgt
aagtacggtcgtgcggaaattgaaggccgtgagtttatctgtattgataccggcgggatt
gatggcacagaagacggtgtagaaacccgcatggcggaacagtcgctgctggcgattgaa
gaagcggacgtcgtactgtttatggtggatgcgcgcgcgggcctgatgccggcagatgaa
gcgattgccaaacatctgcgctcccgtgaaaaaccgaccttcctggtggcaaacaaaact
gacggtctggatcccgatcaggcagtggttgatttctactcgcttggtttaggtgaaatc
tacccgatcgccgcgtctcacggtcgtggcgtattaagtctgctggagcatgtgctgctg
ccgtggatggaagatctcgcaccgcaagaggaagtcgacgaagacgctgaatactgggcg
caatttgaagcggaagagaacggcgaagaagaagaggaagacgacttcgacccgcaaagt
ctgccgatcaaactggcgattgtgggtcgtccgaacgtaggtaagtctacactcactaac
cgtattcttggtgaagagcgcgttgttgtttacgacatgcctggcacgacgcgtgacagc
atctacatcccaatggaacgcgatggacgtgagtatgtgctcattgacaccgctggcgta
cgtaaacgcggcaaaatcaccgatgctgtagagaaattctccgtaatcaaaacgttgcag
gccattgaagacgccaacgtggtgatgttagtgattgatgcgcgcgaaggtatttccgat
caggatctctcgctgctgggctttattctcaatagtgggcgctcacttgtcattgtggtg
aataagtgggatggcctgagtcaggaagtgaaagagcaggtgaaagaaacgctggacttc
cgtctgggctttatcgattttgctcgtgtgcactttatctctgccttgcacggcagtggt
gttggtaacttgtttgaatcagtacgtgaagcgtatgacagctccacccgtcgtgtgggg
acctctatgctgacgcgcatcatgacgatggctgttgaagatcaccaaccgccgctggta
cgcggtcgtcgtgtgaagctgaaatatgcccacgccggtggttataacccgccgattgtg
gtgattcacggtaatcaggtgaaagacctgcctgattcctacaagcgctacttgatgaac
tacttccgcaaatcgctggacgtaatgggatcgccgattcgtattcagttcaaagaaggg
gaaaacccgtatgcgaataagcgtaacaccctgacgccaacccagatgcgtaaacgtaag
cgtctgatgaagcacatcaagaaaaataaataa
              
                            

Download fasta file
RegulonDB