RegulonDB RegulonDB 10.8: Gene Sequence
bamB gene sequence


Size: 1179        A: 258  T: 293  G: 345  C: 283

Fasta

 

>bamB E. coli K12. Version NC_000913.3 GI:556503834
atgcaattgcgtaaattactgctgccaggactgctttccgttacccttttaagcggctgt
tcgctgtttaacagcgaagaagatgtggtaaagatgtccccattgccaaccgttgaaaac
cagtttacgccgaccacggcgtggagcacttccgttggtagcggcattggcaacttctat
tccaatcttcatccggcactggcggacaacgttgtctatgcagcggaccgcgctggttta
gtaaaagcgctgaatgcggatgatggcaaagaaatctggtctgtcagcctggccgagaaa
gatggctggttctctaaagagcctgcattactttctggcggtgtgaccgtgtctggtggg
catgtctacattggcagcgaaaaggcgcaggtttacgcgctgaataccagcgatggtact
gtggcatggcaaactaaagtcgcgggtgaagcactttcgcgcccggtggtcagcgacggt
ctggtgttaatccacaccagtaacggtcagttacaagcgctgaacgaagctgacggcgct
gtcaaatggacagttaacctcgatatgccttcgctctctttgcgtggcgagtctgcgccg
acaacggcttttggtgcggccgtcgtggggggcgataatggtcgcgtcagcgcagtgctg
atggaacagggccagatgatttggcagcagcgtatttcccaggcgaccggttctaccgaa
attgaccgtctgagcgatgttgacacgactcccgtcgttgttaacggcgttgttttcgcg
ctggcctataatggtaacctgacggcgcttgatctgcgcagtggtcagattatgtggaaa
cgcgaactgggttcggtgaatgatttcatcgtcgacggcaatcgcatctatctggtcgat
caaaatgaccgggtgatggcgttgaccattgatggcggcgttacgctgtggacacaaagc
gatctgctgcatcgcctgctgacttctccggtgctgtataatggcaacctggtggtcggt
gacagtgaaggttatctgcactggattaacgtcgaagatggtcgtttcgttgcccagcaa
aaagttgatagttccggtttccagactgaaccggttgccgctgacggcaaactgctgatc
caggcaaaagacggaaccgtgtactctattacacgttaa
              
                            

Download fasta file
RegulonDB