RegulonDB RegulonDB 10.8: Gene Sequence
yfgM gene sequence


Size: 621        A: 171  T: 141  G: 178  C: 131

Fasta

 

>yfgM E. coli K12. Version NC_000913.3 GI:556503834
gtggaaatttacgagaacgaaaacgaccaggtagaagcggttaaacgcttttttgctgaa
aatggcaaagcactggctgttggggtgattttgggcgttggcgcactgattggctggcgc
tactggaacagccatcaggttgattctgcacgctccgcttctcttgcctatcaaaatgcg
gttaccgcagtgagcgaaggcaaaccggatagcatcccggcggcggaaaaatttgctgct
gaaaataaaaatacttatggtgcgctggcttctttggaacttgcgcagcaatttgttgac
aaaaatgaactagagaaagctgccgcccagttacaacaggggctggcagacacgagcgat
gaaaatctcaaagccgtgataaatctgcgtcttgctcgcgttcaggtacagctcaagcag
gctgatgccgcgctgaaaacccttgataccatcaaaggtgaagggtgggctgccattgtt
gccgacctgcgtggtgaagcattgctgagcaaaggtgataagcaaggtgcgcgtagtgca
tgggaagcaggcgtgaaaagcgatgttactccggcactgagcgaaatgatgcagatgaaa
attaataatttgtccatctga
              
                            

Download fasta file
RegulonDB