RegulonDB RegulonDB 10.9: Gene Sequence
iscR gene sequence


Size: 489        A: 110  T: 117  G: 135  C: 127

Fasta

 

>iscR E. coli K12. Version NC_000913.3 GI:556503834
atgagactgacatctaaagggcgctatgccgtgaccgcaatgcttgacgttgcgctcaac
tctgaagcgggcccggtaccgttggctgatatttccgaacgtcagggaatttccctttct
tatctggaacaactgttttcccgtctgcgtaaaaatggtctggtttccagcgtacgtgga
ccaggcggtggttatctgttaggcaaagatgccagcagcatcgccgttggcgaagtaatt
agcgccgttgacgaatctgtagatgccacccgttgtcagggtaaaggcggctgccagggc
ggcgataaatgcctgacccacgcgctgtggcgtgatttgagcgaccgtctcaccggtttt
ctcaacaacattactttaggcgaactggttaataaccaggaagtgctggatgtgtctggt
cgtcagcatactcacgacgcgccacgcacccgcacacaagacgcgatcgacgttaagtta
cgcgcttaa
              
                            

Download fasta file
RegulonDB