RegulonDB RegulonDB 10.8: Gene Sequence
yfhR gene sequence


Size: 855        A: 195  T: 228  G: 210  C: 222

Fasta

 

>yfhR E. coli K12. Version NC_000913.3 GI:556503834
atggcactgccagtgaacaaacgcgttcccaaaattctgtttattctctttgttgttgcc
ttctgcgtttatttagtgccgcgcgttgccatcaacttcttctattatcccgacgataaa
atttacggtcccgatccctggtcggcggaatccgtcgaatttacggctaaggacggtact
cgtctgcaaggctggtttatcccttcttcgacgggccctgctgacaacgccatcgcaacc
atcattcatgctcacggcaatgccggaaatatgtccgcccactggccgctggtcagttgg
ttacccgagcgtaatttcaacgtttttatgtttgattatcgcgggtttggtaaatcaaaa
ggcacgccgtcccaggccggattgctggacgatacgcaaagtgccatcaatgtggtgcgc
catcgcagtgatgtaaacccacaacgtctggtgctgttcgggcagagtattggcggggcg
aatattctggatgttattggtcggggtgatcgtgaaggcatacgtgcggtgatcctcgac
tccacatttgcctcttatgcaaccatcgccaaccaaatgatccccggcagtggctactta
cttgatgagagttacagcggcgaaaattatatcgccagcgtcagcccgatcccgctttta
ctcattcacggtaaagctgatcacgttatcccatggcagcacagcgaaaagttgtatagc
ctggcaaaagagccaaaacggttgatcctaatcccggatggcgaacacattgatgctttt
tccgatcgtcacggcgatgtttatcgcgaacagatggtggactttatccttagcgcgttg
aatccgcagaactaa
              
                            

Download fasta file
RegulonDB