RegulonDB RegulonDB 10.8: Gene Sequence
csiE gene sequence


Size: 1281        A: 291  T: 330  G: 320  C: 340

Fasta

 

>csiE E. coli K12. Version NC_000913.3 GI:556503834
atgatgcctacgcttgctccaccatctgtcctttcggctccccagcgccgctgccagatc
ttgctgacgctctttcagccggggttgaccgccaccatggcaaccttcagcgagcttaat
ggtgtggatgatgatattgccagtcttgatatcagcgaaacaggacgggagatcctgcgc
tatcatcaactcacactgacgactggttatgacggtagctaccgggttgaaggtacagtg
cttaaccaacgtttgtgtttatttcactggctacgacgtggtttccgtctgtgtccgtca
tttattaccagccaattcacccccgccctgaagagtgaactgaagcggcgcggaattgcg
cgtaacttttacgacgataccaatctacaagcgttagtgaatctctgctcccgacggctg
caaaaacgctttgaatcgcgcgatattcatttcctgtgtctgtatctgcaatattgtttg
ctgcagcaccacgctggaattacgcctcagtttaatccgctccaacgtcgctgggcggaa
tcctgccttgaatttcaggtagcgcaggaaattggacgccactggcagcgtcgggcgctc
cagcctgtaccacctgatgagccactgtttatggcactacttttttccatgttgcgggtt
cccgatccattgcgggatgcgcatcagcgggacagacaattgcgtcagtctatcaaacgt
ctggtaaaccattttcgtgagctgggaaatgttcgtttttatgatgaacaggggttatgt
gatcagctttatacccacctcgcccaggcgttaaatcgcagtttgtttgccatcggtatt
gataataccctgccggaagagttcgccagactgtacccacgcctggtgcgcaccacccgc
gcggcgctggccggatttgaaagtgaatacggcgtccatctttctgatgaggaaagtggt
ctggtcgcggtgattttcggtgcctggctaatgcaggaaaacgatctgcatgaaaaacag
attattcttcttaccgggaatgatagcgagcgagaagcgcagattgagcagcagttacgc
gaactaacgttactgccgctcaacattaagcatatgtcggtaaaggcatttttgcagaca
ggcgctccgcgtggcgcggcactgattattgcgccttataccatgccattaccgctcttt
tcaccaccgctgatctatacggacctgacgctgacaacacatcaacaggagcagatccgc
aaaatgctcgaatcagcatga
              
                            

Download fasta file
RegulonDB