RegulonDB RegulonDB 10.8: Gene Sequence
hcaR gene sequence


Size: 891        A: 224  T: 223  G: 242  C: 202

Fasta

 

>hcaR E. coli K12. Version NC_000913.3 GI:556503834
atggaactacggcatttacgctatttcgtcgcagtggcgcaggcactgaactttacccgt
gcggcggaaaaactgcatacctcacagccttcgttaagcagccagatccgcgatcttgaa
aactgtgtcggtgttccgttactggtgagggataagcgcaaagtcgcgttgacggcggcg
ggagaatgttttctccaggacgcgctggcaatcctcgaacaagcggaaaatgccaaatta
cgggcgcggaaaattgttcaggaagacagacaattaaccattggctttgtgccatcggcg
gaagtgaatttactgccaaaagtattaccgatgtttcgtctcagacagccagacaccttg
attgagctggtgagtttaatcaccacgcaacaggaggaaaaaattcgccgtggtgaactc
gacgtcggcttaatgcgccatcctgtttatagcccggagattgattatctggagcttttt
gacgaaccattagtggttgtgttaccggttgatcaccctttagcacatgaaaaagagatc
accgccgcgcaactggatggcgtgaatttcgtcagtaccgatccggtgtattccggttcg
cttgcgccgatcgttaaagcgtggtttgcgcaagaaaacagccagccaaatatcgtccag
gtggcaacgaatattctggtgaccatgaatctggtgggcatggggctgggcgtcactttg
atacccggttatatgaataattttaataccggacaggttgtttttcgtcccattgccgga
aatgtgccttccattgctttactgatggcgtggaagaaaggggagatgaagccggcatta
cgcgatttcatcgccattgtgcaggaacgtttggcaagcgtaacggcataa
              
                            

Download fasta file
RegulonDB