RegulonDB RegulonDB 10.8: Gene Sequence
hcaC gene sequence


Size: 321        A: 67  T: 76  G: 91  C: 87

Fasta

 

>hcaC E. coli K12. Version NC_000913.3 GI:556503834
atgaatcgaatttatgcgtgtcccgttgcggatgtgccggagggtgaggctctccggatc
gatacctcgcccgtcatcgccctgttcaacgttggcggcgagttttatgccattaacgat
cgttgcagccatggtaatgcgtcaatgtcagaagggtatctggaagatgacgccacggtg
gagtgcccgctacacgccgccagtttttgcctgaaaacggggaaagcgttatgcctgccc
gccaccgatccgctcaccacttatccagtacacgttgaaggtggtgacattttcatcgac
ttaccggaggcgcagccatga
              
                            

Download fasta file
RegulonDB