RegulonDB RegulonDB 10.8: Gene Sequence
hcaB gene sequence


Size: 813        A: 171  T: 186  G: 241  C: 215

Fasta

 

>hcaB E. coli K12. Version NC_000913.3 GI:556503834
atgagcgatctgcataacgagtccatttttattaccggcggcggatcgggattagggctg
gcgctggtcgagcgatttatcgaagaaggcgcgcaggttgccacgctggaactgtcggcg
gcaaaagtcgccagtctgcgtcagcgatttggcgaacatattctggcggtggaaggtaac
gtgacctgttatgccgattatcaacgcgcggtcgatcagatcctgactcgttccggcaag
ctggattgttttatcggcaatgcaggcatctgggatcacaatgcctcactggttaatact
cccgcagagacgctcgaaaccggcttccacgagctgtttaacgtcaatgttctcggttac
ctgctgggcgcaaaagcctgcgctccggcgttaatcgccagtgaaggcagcatgattttc
acactgtcaaatgccgcctggtatcctggcggcggtggcccgctgtacaccgccagtaaa
catgccgcaaccggacttattcgccaactggcttatgaactggcaccgaaagtgcgggtg
aatggcgtcggcccgtgtggtatggccagcgacctgcgcggcccacaggcgctcgggcaa
agtgaaacctcgataatgcagtctctgacgccggagaaaattgccgccattttaccgctg
caatttttcccgcaaccggcggattttacggggccgtatgtgatgttgacatcgcggcgc
aataatcgcgcattaagcggtgtgatgatcaacgctgatgcgggtttagcgattcgcggc
attcgccacgtagcggctgggctggatctttaa
              
                            

Download fasta file
RegulonDB