RegulonDB RegulonDB 10.8: Gene Sequence
hcaD gene sequence


Size: 1203        A: 285  T: 268  G: 341  C: 309

Fasta

 

>hcaD E. coli K12. Version NC_000913.3 GI:556503834
atgaaagaaaaaacgatcattattgtcggtggcgggcaagcggcggcaatggctgcggcc
tcgctacgccagcaagggttcaccggtgagctgcatctgttttccgatgagcgacatctt
ccttatgaacgacctccactctcgaaatccatgttgctggaagattccccgcagttacag
caggtgttacccgctaactggtggcaggaaaacaatgttcatctgcattccggtgtaacc
atcaaaacgctgggtcgcgacacacgagagttagtgttaaccaacggcgaaagctggcac
tgggatcagctttttatagcaaccggcgcggcagctcgaccgctgccgttgcttgatgca
ctgggagaacgctgctttaccctacgccatgccggtgatgccgccagactgcgagaagtt
ctgcagcccgaacggtcagtcgtgattatcggtgccggaactattggtctggaactggct
gccagcgccacgcagcgcagatgtaaggtgacagtgattgaactggcggcaaccgtcatg
ggccgtaatgcaccaccgcccgtgcaacgctatcttttacagcgccaccagcaggctggt
gtgcgcattctgctcaataatgccattgaacatgtggtcgatggtgaaaaagtagaactg
acgctgcaaagtggggaaacgcttcaggctgatgtggtgatttacggtattggtatcagc
gccaacgagcaactggctcgcgaggccaaccttgatactgccaatggcattgtcattgat
gaggcttgccgcacctgcgatcccgcgatctttgccggtggcgatgtggcaatcactcgt
cttgataatggtgcactacaccgctgcgaaagctgggaaaacgccaataaccaggcgcaa
attgccgctgccgcaatgttagggctaccgctaccgctactgccgccgccgtggttctgg
agcgatcagtacagtgataacttacagtttattggcgatatgcgtggcgatgactggctt
tgtcgtggcaacccggaaactcagaaggcgatttggtttaatctgcaaaacggcgtgctt
atcggtgcggtcacgctgaatcaggggcgtgagattcgcccaattcgcaaatggatccag
agcggcaaaacgtttgatgcgaaactgctgatagatgagaacatcgcgcttaaatcactg
taa
              
                            

Download fasta file
RegulonDB