RegulonDB RegulonDB 10.8: Gene Sequence
yphA gene sequence


Size: 423        A: 76  T: 137  G: 116  C: 94

Fasta

 

>yphA E. coli K12. Version NC_000913.3 GI:556503834
atgaacacactacgttattttgattttggagctgcccgccccgttttgttattaattgcc
cgtatcgccgtggtcttaattttcattatttttggttttcccaaaatgatgggctttgac
ggtacggtccaatatatggcctcgttgggcgcgccaatgccgatgctggcagcgattatt
gcggtagttatggaagtgcccgccgcgatattaatcgtgcttggctttttcacccgtccg
ctggcggtgctgtttattttctacacgctgggtacggcggtgattggtcaccattactgg
gatatgaccggcgatgcggttgggccaaatatgattaatttctggaagaatgtcagtatc
gctggcgcgttcttgctattggcaattaccgggccgggggcaatttctctcgatcggcgt
tag
              
                            

Download fasta file
RegulonDB