RegulonDB RegulonDB 10.8: Gene Sequence
yphB gene sequence


Size: 873        A: 180  T: 211  G: 268  C: 214

Fasta

 

>yphB E. coli K12. Version NC_000913.3 GI:556503834
atgaccatctataccttatcccacgggtcgctaaagctggacgtttctgaccagggcggc
gtaatcgaaggcttctggcgcgatacgacgccgctcttacgtcctggtaaaaaaagcggt
gtggcaaccgatgcctcatgttttccgctggtgccatttgcaaaccgggtgagcggcaat
cgttttgtctggcaggggcgtgagtatcaactgcaaccgaatgttgagtgggatgcgcac
tatctacacggcgatggctggctgggcgagtggcaatgtgtctcgcacagcgatgatagt
ttgtgtctggtgtatgaacatcgcagcggtgtctatcactatcgggtaagtcaggcgttt
catttaacggcggatacgctgacggtgacgctctctgtcaccaatcaaggggcagagacg
ctgccatttggtaccggctggcatccttattttccgttgtcgccgcaaacgcggattcag
gcacaggcgagcggttactggctggagcgggagcagtggctggcgggtgagttttgcgag
cagctaccgcaggaactggattttaaccagcccgcgccgttgccgcgccagtgggtgaac
aatggttttgccggatggaatggtcaggcccgcatcgagcagccgcaggaaggttatgcc
atcatcatggaaacgacgccacctgcaccgtgttatttcatctttgtttccgaccctgcg
tttgataaaggatatgcgtttgatttcttctgtctggaaccgatgagccatgcgccggat
gatcatcatcgcccggaagggggtgatctcattgcgctagcaccaggggaatcaacaact
tcagagatgtcgttgcgggtagagtggctgtaa
              
                            

Download fasta file
RegulonDB