RegulonDB RegulonDB 10.8: Gene Sequence
yphC gene sequence


Size: 1062        A: 234  T: 242  G: 332  C: 254

Fasta

 

>yphC E. coli K12. Version NC_000913.3 GI:556503834
atgaaaacgatgctggcagcttatttaccaggaaattcgaccgtcgatctgcgggaagtt
gcggtgccgacgccggggattaaccaggtactgatcaaaatgaaatcctccgggatttgc
ggaagcgatgtccactatatctatcatcaacaccgtgccacagcggcggcacccgataaa
ccgttataccagggctttatcaacggtcatgaaccgtgcgggcagattgtggcgatgggg
caaggctgccgccattttaaagagggcgaccgcgtgctggtgtatcacatttctggctgt
ggtttttgcccgaactgccgtcgcggttttcctatttcttgtactggcgaaggaaaagcg
gcttacggctggcagcgtgacggcggtcatgccgaatacttgctggcggaagaaaaagat
ctgatcctcctgccggatgcgctgagctacgaagatggtgcgtttatcagttgcggcgtt
ggtacagcgtatgaaggaattttgcgcggcgaagtttccggcagtgataacgtgctggtg
gtcggtctggggccagtcggcatgatggcgatgatgctggcgaaaggtcgcggtgcaaaa
cggatcatcggcgttgatatgctgccggaacgtctggcgatggcaaaacagttaggggtg
atggatcacggctatttagcaaccaccgaaggtctgccgcagattatcgccgaactcacc
cacggtggcgcggatgttgcgctcgattgttccggtaatgccgcaggtcgcttgctggca
ctgcaatccaccgctgactggggacgggtggtttacattggtgaaaccggaaaagtggaa
ttcgaggtcagcgccgatctgatgcaccatcaacggcggattatcggctcctgggtgacc
agtctgttccatatggaaaaatgcgcccatgatctgacggactggaagctgtggccgcgt
aacgccattacccatcgcttctcgctggaacaggcaggtgatgcctatgcgctgatggcg
agcggcaaatgcgggaaagttgtgattaacttcccggattaa
              
                            

Download fasta file
RegulonDB