RegulonDB RegulonDB 10.8: Gene Sequence
yphD gene sequence


Size: 999        A: 154  T: 284  G: 318  C: 243

Fasta

 

>yphD E. coli K12. Version NC_000913.3 GI:556503834
atgtctgcttcgtcattaccattgccgcagggcaagagcgtctcgctcaaacaatttgtc
agtcgccatattaatgagatcggtttgctggtggtgattgccattctttatctggtcttc
tccctgaacgcgcctggctttatctcattgaataaccagatgaacgtgctgcgcgatgcc
gccaccattgggattgccgcctgggcgatgacgctgattattatctccggtgaaattgat
gtcagcgttgggccgatggtggcttttgtctcggtgtgcctggcatttttgctgcaattt
gaagttccgctggcggtggcgtgcctgctggtgttgctgttaggcgcgctgatgggaacg
ctggccggggtgctgcgcggcgtgtttaatgtaccaagtttcgttgccacactggggctg
tggagcgccctgcgcggaatggggctgtttatgacgaacgcactgccagtgccgattgat
gaaaacgaggtgctggactggctgggcggacaatttctcggtgtgccggtatccgcgctg
atcatgattgtgttgtttgcgctgtttgtgttcatcagccgcaaaaccgccttcgggcgc
tcggtttttgccgttggcggtaatgctacggcggcgcagttgtgcggcatcaacgttcgt
cgggtgcgcattcttatctttaccctttcgggattattagcggcggtgaccggcattttg
ttggcggcgcgcctcggttctggtaacgcaggtgccgcaaacggtctggagtttgacgtc
atcgccgcggtcgtggtcggcggtacggcactttccggcggtcgcggttccctgttcggt
acattgcttggtgtgctggtgattacgctaatcggtaacggtctggtgctgctcggtatt
aactcctttttccagcaggtggtacgcggcgtcatcatcgtggtggcggtgctggcgaat
atcttgctgacccagcgaagcagtaaagcgaaacgctaa
              
                            

Download fasta file
RegulonDB