RegulonDB RegulonDB 10.8: Gene Sequence
yphE gene sequence


Size: 1512        A: 341  T: 323  G: 480  C: 368

Fasta

 

>yphE E. coli K12. Version NC_000913.3 GI:556503834
atgttcacggcaacagaggcagtcccggtagcaaaagtggtggcaggaaataagcgttat
cccggcgtcgttgcgctggataacgttaacttcacgctcaataaaggcgaagttcgtgcg
ctgttaggtaaaaacggcgcgggcaaatcgactctcattcgaatgcttaccggcagcgaa
cgcccggatagcggtgatatctggattggcgagacgcgactggaaggtgacgaagctacg
ctgactcgccgtgccgctgaactgggggtgcgcgcggtttatcaggagttaagtctggtg
gaagggctgacagtggcggaaaacctctgcctcggtcagtggccccgccgcaacggcatg
attgattacctgcaaatggcgcaggatgcccaacgttgcttacaggcgctgggcgttgac
gttagtcctgaacaacttgtttcaacgctaagcccggcgcaaaagcagctggtggaaatt
gcgcgggtgatgaagggcgagccgcgcgtggtcattcttgatgaacctaccagttcgctt
gcgagtgcggaagttgaactggtgatcagcgcggtgaaaaagatgtcggcactgggcgtg
gcggtgatttatgtcagccaccggatggaagaaattcgccgcattgcctcctgtgccacc
gttatgcgcgatggtcaggtggcgggcgatgtgatgctcgaaaacacctccacgcatcat
attgtgtcgctgatgctcgggcgcgatcacgttgatattgcgccggtagcccctcaggaa
attgtggatcaggccgtgctggaagtccgtgcgttacgccataagcccaagctggaggat
atcagttttacgctacgtcgtggcgaagtgctcggcattgctggtctgctgggggcaggg
cgcagtgaattgctgaaggcgattgttgggctggaggagtatgaacagggcgaaattgtt
atcaacggcgagaaaatcacgcgccccgattacggcgacatgctgaaacgcggcattggc
tatacgccagaaaaccgcaaagaagcggggatcattccctggttgggcgttgacgaaaat
acagtgctgaccaatcggcaaaaaatcagcgccaacggtgtgctgcaatggtccaccatc
cgccgcctgaccgaagaggtgatgcagcggatgacggtcaaggccgccagtagcgaaaca
cccatcggcacgctttctggtggcaatcagcaaaaagtggtgatcggtcgttgggtctat
gctgccagccagattttgttgctcgacgagccaacgcgcggcgtcgatatcgaagccaaa
cagcagatttaccgtattgtccgtgagctggctgccgaaggaaaaagcgtggtgtttatc
tccagtgaagtggaggagttgccgctggtgtgtgaccgcatcctgttattacagcacggc
acgttctcgcaggagtttcacgctccggtcaatgtggatgagctgatgtccgccattctg
tctgtgcactga
              
                            

Download fasta file
RegulonDB