RegulonDB RegulonDB 10.8: Gene Sequence
yphF gene sequence


Size: 984        A: 286  T: 244  G: 253  C: 201

Fasta

 

>yphF E. coli K12. Version NC_000913.3 GI:556503834
atgcctacaaaaatgagaacaacccgtaatctattattaatggctacgctattaggtagc
gcactatttgccagggctgcggaaaaagaaatgaccattggcgcaatataccttgatact
cagggatactacgctggagtgcgtcagggcgttcaggatgcggcaaaagattcctcagta
caagttcagttaatagaaactaacgcccagggtgatatttcgaaagaaagtacctttgtt
gataccctcgtggcgcgtaatgtcgatgccattattttatcggcagtgtctgaaaatggc
agtagccgtaccgttcgtcgcgccagtgaagcgggcattccggtgatttgctacaacacc
tgtattaatcaaaagggggtcgataaatatgtctcggcgtatctggtcggcgatccgctg
gaatttggtaaaaaactgggtaacgctgccgctgattattttattgccaataaaattgac
cagccgaaaattgccgtcatcaattgcgaagcctttgaagtttgtgtgcagcgacgtaaa
ggatttgaagaagttttaaaatcccgcgttcccggcgcgcaaattgtcgctaatcaggaa
gggactgttttagataaagcgatttccgttggtgaaaaactaattatctccacgccggat
ctcaacgccattatgggggaatcgggcggtgcgacactcggcgcggtaaaagcggtacgt
aatcaaaatcaggccggaaaaattgctgttttcggttcggatatgacaaccgaaattgct
caggagctggaaaacaatcaggtgctgaaagcggtagtggatatttccggtaagaaaatg
ggcaatgctgttttcgcgcaaacattgaaggttatcaataaacaagccgacggtgaaaaa
gtgattcaggtgcctatcgatctctataccaaaacggaagacggtaaacagtggctggca
acgcacgttgatggtctgccctaa
              
                            

Download fasta file
RegulonDB