RegulonDB RegulonDB 10.8: Gene Sequence
yphG gene sequence


Size: 3282        A: 758  T: 723  G: 954  C: 847

Fasta

 

>yphG E. coli K12. Version NC_000913.3 GI:556503834
atgactccagtaaaagtgtggcaagagcgcgttgagatcccgacctatgaaaccgggccg
caggatatacatcccatgttcctggaaaatcgcgtttatcagggatcgtccggcgcggtt
tatccctacggcgtgaccgatacgctgagcgagcagaaaaccctgaaatcctggcaggcg
gtgtggctggaaaacgactacatcaaagtgatgatcctgccggaactgggcggtcgggtg
catcgcgcgtgggataaagtgaaacagcgcgattttgtttatcacaatgaagtcattaaa
cctgcgctggtggggctgctggggccgtggatttccggtgggattgagtttaactggccg
caacatcatcgcccgaccacctttatgcccgttgatttcaccctcgaagcccatgaagac
ggtgcacagacggtgtgggtaggcgaaacggagccgatgcatggtttacaggtgatgaca
ggtttcaccctgcgccctgaccgggcggcgctggaaatcgccagccgcgtctataacggg
aacgccacgccgcgtcatttcttgtggtgggccaacccggcagtgaaagggggggaaggg
catcagagcgtcttcccgccggatgtaacggcggtgtttgatcacggcaaacgggccgtc
tccgctttccccatcgctaccggcacttactacaaagtggactactccgctggagtggac
atttctcgctataaaaatgtgcctgttccaacctcatatatggccgaaaaatcgcagtac
gattttgtcggcgcgtggtgtcacgatgaagatggcggtttgctgcacgttgccaaccac
catattgcgccaggtaaaaaacagtggagttggggacacagtgaatttggccaggcgtgg
gataagagtctgaccgacaataacggcccgtatatcgaactgatgaccggtatttttgcc
gataaccagcccgattttacctggcttgatgcttacgaagagaagcgttttgagcagtat
ttcctgccttatcattctttgggcatggtgcaaaatgcctcccgcgatgcggtgataaaa
ctccagcgtagtaagcgggggattgagtgggggctgtatgccatctctccgttgaacgga
taccgcctggcgatccgcgaaatcggtaaatgcaacgcgttacttgatgatgccgtggca
ctgatgcctgcgaccgccatccagggcgtgttgcacggtatcaatcctgaaaggctgacc
attgagctctccgatgccgacggcaatattgtactgagttatcaggaacatcagccgcaa
gcgttgccgttaccggacgtcgccaaagcgccactggcagcacaagacattaccagtaca
gatgaagcctggtttatcggtcagcatctggagcaatatcatcacgccagccgttcaccg
ttcgattactacctgcgcggcgtggcgctggacccgctggattatcgctgtaacctggcg
ctggcgatgctggaatataaccgcgcagatttcccgcaagcggtggcgtatgccactcag
gctctgaaacgcgcacatgcgctgaacaaaaatccgcagtgcggacaggcgagtttgatt
cgcgccagtgcttacgaacgtcagggacaatatcaacaagccgaagaggatttctggcgt
gcggtctggagcggcaacagcaaagccggtggctattatggcctggcacgactggcggcg
cgtaatggtaacttcgacgctggtctggatttttgccaacaaagtcttcgcgcctgccca
accaatcaggaagtgctttgcctgcataatctgctgctggtgttaagtggtcgtcaggac
aacgcgcgtgtgcagcgcgagaaactgctgcgcgattatccgctgaacgccactctgtgg
tggctgaactggttcgatggtcgtagcgaatcagctctcgcgcagtggcgcggtctgtgt
cagggacgcgacgttaacgccctgatgaccgccgggcaactgattaactggggaatgccc
accctggcggcagagatgctgaacgcactggactgccagcgcacgctgccgctttacctg
caagccagcttgctgccgaaagccgaacgtggcgaactggtcgcaaaagccattgatgtc
ttcccgcagtttgtccgtttcccgaatacgctggaagaagtggcggcgctggagagtatt
gaagagtgctggtttgctcgccatttactagcttgcttctactacaacaaacgtagctac
aacaaagccattgccttttggcaacgttgcgtagagatgtcgccggagtttgccgacggc
tggcgcgggttagcgatccatgcgtggaataagcaacacgattatgagctggccgcgcgt
tatcttgataatgcttatcagcttgcgccgcaggatgcacgtctgcttttcgaacgggat
ttgctggataagttaagtggagccacaccggagaaacgactggcgcgtctggaaaataat
ctggaaattgcgctgaaacgcgacgacatgaccgcagaactgctcaatttgtggcatctc
acgggtcaggcagacaaagcggcggacattctcgccacgcgcaaattccacccgtgggaa
ggcggggaagggaaggtcaccagtcagtttatcctcaaccagttattacgcgcctggcag
catcttgatgccagacagccgcagcaggcctgcgaactgcttcatgccgcgctgcattat
ccggagaatttaagcgaaggccgtttaccggggcaaactgataacgacatctggttctgg
caggcgatatgcgccaacgcgcagggcgatgaaactgaagcgacgcgttgtttacgtctg
gcggcgaccggcgatcgcactattaacattcacagttattacaacgatcagccggttgat
tatctcttctggcaagggatggcgctgcgactgctgggcgaacaacaaaccgcacagcaa
ctgtttagtgaaatgaaacagtgggcgcaagagatggcgaaaaccagtatcgaagcggat
ttctttgccgtctcgcaacctgacttgttgtcgctgtatggcgatttacaacagcagcat
aaagaaaaatgcctgatggtggcgatgctggcgtccgcgggactcggggaggttgcgcaa
tatgagtctgctcgcgctgaattgacggcgattaatccggcttggccgaaagcggcatta
ttcaccaccgtgatgccttttatttttaaccgcgttcactaa
              
                            

Download fasta file
RegulonDB