RegulonDB RegulonDB 10.8: Gene Sequence
yphH gene sequence


Size: 1194        A: 307  T: 283  G: 336  C: 268

Fasta

 

>yphH E. coli K12. Version NC_000913.3 GI:556503834
atgagagcctgcattaataatcaacagattcgccaccataacaaatgcgtgattctggaa
ctgctgtaccggcaaaagcgcgccaataaatcaacgctggcccggctggcgcaaatttcg
attccggcagtcagtaatattttgcaggaactggaaagcgaaaaacgggtggtgaatatt
gacgatgaaagccagacgcgcgggcatagtagcggtacatggctgattgcgccggaaggt
gactggacgctgtgcctgaacgtgacgcccaccagtattgagtgtcaggttgctaatgct
tgtttaagtccgaaaggtgaatttgagtatttacagattgatgcaccgacgccgcaggcg
ctgctgtccgaaatcgaaaaatgctggcatcgccaccgtaaattgtggccggaccatacc
atcaacctggcgttggcaatccacggtcaggttgatcctgtgaccggcgtgtcgcaaacc
atgccgcaagcgccgtggacaacgccggtggaggtgaaatatctgctggaagagaagctc
ggcattcgggtgatggtcgataatgactgcgtgatgctggcgctggcggagaaatggcaa
aataattcgcaggaacgggatttctgcgtgatcaacgttgattacggcattggctcgtcg
ttcgtgattaacgagcaaatttatcgcggcagtttgtatggtagcggacagattggtcac
accatcgttaatccggatggcgtcgtctgcgactgtggacgttatggctgcctggaaact
gtcgcctcgttaagcgcattaaaaaaacaggcgcgggtatggctaaaatcacaaccggtt
agtactcaacttgatcctgaaaaactgactacagcgcagttaatcgctgcctggcaaagt
ggagaaccgtggatcaccagctgggttgatcgctctgccaatgccattggtttgagtctg
tataacttcctcaacatcctcaatattaatcagatttggttgtacggtcgcagttgtgcc
tttggtgagaactggcttaatactattattcgccagacaggatttaacccgttcgaccgc
gacgaaggaccgagcgtgaaagcgacgcaaattggctttgggcaattaagccgcgcacaa
caggtgctgggaattggctatttgtatgttgaggcgcagttacgacagatttga
              
                            

Download fasta file
RegulonDB