RegulonDB RegulonDB 10.8: Gene Sequence
ypjD gene sequence


Size: 792        A: 156  T: 219  G: 206  C: 211

Fasta

 

>ypjD E. coli K12. Version NC_000913.3 GI:556503834
atgcccgtttttgctctgctcgcgcttgtcgcctactccgtcagtcttgcgctgattgtt
cccggtctgctgcaaaaaaacggcggctggcggcgcatggctattatttctgcggtcatt
gcgctggtctgccacgcaatcgctctggaagcccgcatcctgcccgacggtgatagcgga
caaaacctcagcctgctgaacgttggttcattggtcagtttgatgatctgtacggtaatg
accattgtggcttctcgcaatcgtggctggctgctgctacccattgtctatgcctttgcg
cttatcaacctggcgctggcaaccttcatgcccaatgaatacatcacccatctggaagct
acgcctgggatgctggtgcacattggcttatcgctcttttcctatgccacgctaattatc
gccgccctgtacgcgctgcaactggcgtggattgattaccaactgaagaacaagaagctg
gcgtttaaccaggaaatgccgccattgatgagtatcgagcgtaaaatgttccacatcacg
cagattggcgtggtgctgctaacgctcacgctttgcactggcctgttctacatgcacaac
ttatttagcatggaaaatatcgacaaggctgtgctctctatcgtggcgtggtttgtctat
attgtgctgctgtggggacattatcatgaaggatggcgtggacgccgcgtcgtctggttt
aacgttgcgggcgcggtaattctgacactggcctacttcggcagccgaattgtccagcag
ttaatcagctaa
              
                            

Download fasta file
RegulonDB