RegulonDB RegulonDB 11.1: Gene Sequence
yfjH gene sequence


Size: 957        A: 328  T: 277  G: 205  C: 147

Fasta

 

>yfjH E. coli K12. Version NC_000913.3 GI:556503834
atgggtatctttaaggcaaaaaacccatgtaccaaaaatacaatttttacaacctctaat
acattgatttatggtggttttatgatttctctgaatgatttttatgaacaaatttgtaga
aaacgacgtgatctcgcctatcacatgtccgaatgcgaatgggcggtggatactgatgtt
ctagaggaagatcatccggaaatacggattgagctaggcagaatgcgagagcaattctgg
agctctgagaaaataggtactcgtgtgaggttatattcctgcgatgtaccatgggaaaca
aggcaccatacagtgaatgggcaactggagataaaggaagaatacactgaattatatgat
ccagctcaagaatgctggaaaaatctaagttcaaaccttaccaaggaaacgtttttacct
cttgttatcgagccattttccattaatgacattttcaaggcacaccttatgttcgcctca
atctcttttttctggggaaaatctatcatgtctgaaaatgaaaacgttgcctttaaagca
tttcatcgggctgcggagttatttgataagtgcataggtatgacttggtttaacatctct
gtttgtaatcaaaaaaaattatcagaagtcaggcggagtgcaggaaagaagggtggcaaa
agcaaagcggaagtgtaccatatcattcaactgaagttggttgagctaattaatgactct
gttccgaatgatgggtggaaaaataaggttgtagcagttaatgaacttatcgaaccgcta
tgggattttattcaaatgtcagagtttgagataaataatcaaaataaaaaatatcgtgta
gcaacaatgagtcaagatgctttggttgatactattttaaatcaatggtctttaaaaaat
gaagatgtaaaacaagctttcgatagcgctgttcgtagaaaaaaaagaagtaaataa
              
                            

Download fasta file
RegulonDB