RegulonDB RegulonDB 10.8: Gene Sequence
rnlA gene sequence


Size: 1074        A: 299  T: 299  G: 245  C: 231

Fasta

 

>rnlA E. coli K12. Version NC_000913.3 GI:556503834
atgacaatcaggagttacaaaaacttaaatctggtcagggcaaatatcgagactgaatcc
agacaattcattgaaaataaaaactattcaatccaatcaattggtcctatgccagggtca
agggctgggcttcgggtcgtatttaccagaccaggggttaacttggcaactgtggacatt
ttttataacggggacggttcgactacaattcaatatctcactggagccaatcgttctctg
ggccaagagttagcggatcatctttttgaaaccatcaatcctgctgaatttgagcaggta
aatatggtactgcaaggatttgtagagacaagcgttctacctgtacttgagctatcagca
gatgaatcgcatatagagttcagagaacactctcgtaacgctcataccgtagtgtggaaa
attatttccaccagctatcaggacgaattgactgtgagcctgcatatcacaacaggtaag
ctccagattcagggccgaccgctgtcatgttacagagttttcacgtttaacttggcagcc
ctgcttgatttacagggtttggagaaagtgctaatccgccaggaggatggtaaagctaat
attgttcaacaggaggttgcccgcacttacttgcagactgtaatggccgatgcttacccg
catctccacgtgactgccgaaaaattgctcgtttcagggctatgtgttaaactcgccgcc
cctgatttgcctgactactgtatgttactttatcctgaactacgcaccattgaaggtgtc
ttaaaaagtaagatgagtgggttaggcatgccagtacagcagccggcaggttttggaact
tactttgataaacctgctgctcattacattctgaaaccgcaatttgcagctactcttaga
ccggaacagattaacatcatcagcacagcctatactttttttaatgtggaacgtcattct
ctgttccacatggaaactgtggtcgatgccagccgtatgatttctgatatggcccggttg
atgggtaaagccactagagcgtggggaataatcaaggacttatatattgtttga
              
                            

Download fasta file
RegulonDB