RegulonDB RegulonDB 10.8: Gene Sequence
rnlB gene sequence


Size: 372        A: 93  T: 108  G: 86  C: 85

Fasta

 

>rnlB E. coli K12. Version NC_000913.3 GI:556503834
ttgtttgaaatcaccggaattaacgtctcaggggctctaaaagctgtcgttatggcgacc
ggcttcgagaaccctttgtcctcagttaatgaaattgagacgaaactttctgccctactg
ggtagtgagaccactggtgaaatcctttttgacctcttgtgcgctaacggtccagagtgg
aaccgcttcgttacgctggaaatgaaatatggccggatcatgctggatacggccaaaatt
attgatgagcaggacgttccgacacatatcctgagcaaactgacttttactttacgtaat
catcctgagtacctagaagcctctgttttgtctcccgatgatgtacgccaagtcctgtca
atggatttttga
              
                            

Download fasta file
RegulonDB