RegulonDB RegulonDB 10.10: Gene Sequence
kbp gene sequence


Size: 450        A: 136  T: 96  G: 125  C: 93

Fasta

 

>kbp E. coli K12. Version NC_000913.3 GI:556503834
atgggtctgttcaattttgtgaaagatgccggagaaaaactctgggacgcggttacaggt
cagcacgataaagacgatcaggcgaagaaggtgcaggagcatctgaacaaaaccggtata
ccggatgccgataaagtgaatattcaaattgccgacggcaaagcgacggtcactggtgac
ggcctgagtcaggaggcgaaggagaaaatccttgttgcggtggggaatatttccggtatt
gccagtgtcgatgatcaggtgaaaacggcgacaccagccactgccagccagttttatacc
gttaagtctggcgacactctgagtgccatttccaaacaggtctacggtaacgctaatctg
tacaataaaatcttcgaagcgaataaaccgatgctaaaaagcccggataaaatttatccg
gggcaagtgttgcgtattccggaagagtag
              
                            

Download fasta file
RegulonDB