RegulonDB RegulonDB 10.8: Gene Sequence
yqaE gene sequence


Size: 159        A: 28  T: 50  G: 43  C: 38

Fasta

 

>yqaE E. coli K12. Version NC_000913.3 GI:556503834
atgggtttctggagaatcgtcatcaccatcattctgccgccgctcggcgtgctgctcggt
aaagggttcggttgggcgttcattattaatattctgttgacactgcttgggtatatcccc
ggtttgattcacgcgttctgggtgcaaacccgcgattaa
              
                            

Download fasta file
RegulonDB