RegulonDB RegulonDB 10.8: Gene Sequence
ygaV gene sequence


Size: 300        A: 78  T: 63  G: 75  C: 84

Fasta

 

>ygaV E. coli K12. Version NC_000913.3 GI:556503834
atgactgaactcgcgcaattacaggccagtgccgaacaggcagcggccttattgaaagca
atgagccaccctaaacgattgctgattctgtgcatgcttagcggttcccccggcaccagc
gcgggagagctgacgcgcattaccggactgagtgcctctgcgacatcacagcatctcgct
cgtatgcgggacgaagggcttatcgacagccaacgggatgcccaacgcattctatattcc
attaaaaatgaggcggtaaatgccattatcgccaccctgaaaaatgtctattgtccgtaa
              
                            

Download fasta file
RegulonDB