RegulonDB RegulonDB 10.8: Gene Sequence
ygaP gene sequence


Size: 525        A: 139  T: 145  G: 133  C: 108

Fasta

 

>ygaP E. coli K12. Version NC_000913.3 GI:556503834
atggctttgacaaccatttcgccgcatgatgcacaagaattaatcgcacgcggcgcaaag
ttaatcgatattcgtgatgctgatgaatatcttcgtgaacatattcctgaagcagatctg
gctccattatccgtgctggaacagtcaggtcttccggctaaattacgtcacgagcaaatt
atattccactgccaggcaggtaaacgcaccagtaataatgccgataaattagcagcgatt
gccgcccccgcagaaatctttttactcgaagatgggattgatggctggaaaaaagcagga
ttgccagtagcggtaaataaatctcaacccttgccgttaatgcgccaggtgcagatcgct
gcgggtggtttaatattaatcggcgttgtactgggttataccgtaaatagcggtttcttc
ttattaagtggctttgttggtgccgggttactgtttgcaggaatcagcggtttttgtgga
atggcaaggttgttagataagatgccgtggaaccaacgagcttga
              
                            

Download fasta file
RegulonDB