RegulonDB RegulonDB 10.8: Gene Sequence
alaE gene sequence


Size: 450        A: 91  T: 138  G: 124  C: 97

Fasta

 

>alaE E. coli K12. Version NC_000913.3 GI:556503834
atgttctcaccgcagtcacgcttgcgtcatgcagttgcagatacgttcgcgatggttgtt
tactgttctgtcgtgaacatgtgtattgaagttttcctctccggaatgagcttcgaacag
tctttttattccagattggtagcgattccggtgaacatcttaattgcatggccatacggt
atgtaccgtgatctgtttatgcgcgcggcacgcaaagttagcccgtcgggctggataaaa
aatctggcggatatcctggcttatgtgacgttccagtcaccggtgtatgtggcgatcttg
ttagtggtgggcgcagactggcatcagattatggcggcggtcagttcaaacatcgttgtt
tcgatgttgatgggggcggtttatggctacttcctcgattattgccgccgactgtttaaa
gtcagccgttaccagcaggtaaaagcctga
              
                            

Download fasta file
RegulonDB